View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1296_high_11 (Length: 322)
Name: NF1296_high_11
Description: NF1296
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1296_high_11 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 184; Significance: 1e-99; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 70 - 273
Target Start/End: Complemental strand, 50424592 - 50424389
Alignment:
| Q |
70 |
tatattatgtcttatagaacaaggataacatttaaataacttttgaaatactctaaaactcaaaattcacaatactttatggaacagtttagaacaaatc |
169 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50424592 |
tatattatgtcttatagaacaaggataacatttaaataacttttgaaatactctaaaactcaaaattcacaatactttatggaacagtttagaacaaatc |
50424493 |
T |
|
| Q |
170 |
tttggctagccacatatatgatattaaatctgtaagtatagatattacacttgatcttagcaaaagacccggtaaaggtaagcattgttttgcgttatgt |
269 |
Q |
| |
|
|| |||||||||||||| |||||||||| || ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50424492 |
ttaggctagccacatatttgatattaaacctataagtatagatattacacttgattttagcaaaagacccggtaaaggtaagcattgttttgcgttatgt |
50424393 |
T |
|
| Q |
270 |
cttt |
273 |
Q |
| |
|
|||| |
|
|
| T |
50424392 |
cttt |
50424389 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 265 - 309
Target Start/End: Complemental strand, 21643837 - 21643793
Alignment:
| Q |
265 |
tatgtctttgaaaattactgttgtttcggatacgtaggctagtct |
309 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21643837 |
tatgtctttgaaaattactgttgtttcggatacgtaggctagtct |
21643793 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 70
Target Start/End: Complemental strand, 50424929 - 50424889
Alignment:
| Q |
30 |
ggtttatggtaacaatcaatatgcttgttaatatagtgtat |
70 |
Q |
| |
|
||||||||||||| ||||| ||||||||||||||||||||| |
|
|
| T |
50424929 |
ggtttatggtaactatcaacatgcttgttaatatagtgtat |
50424889 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University