View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1296_low_13 (Length: 445)
Name: NF1296_low_13
Description: NF1296
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1296_low_13 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 128; Significance: 5e-66; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 128; E-Value: 5e-66
Query Start/End: Original strand, 145 - 341
Target Start/End: Complemental strand, 23029433 - 23029232
Alignment:
| Q |
145 |
attaaattgatcgttttcatgt------aaattttcaacgaaatgaatgaacaattcttgagaaaaacaaagaattgagaagccaaaatgacaaaaacta |
238 |
Q |
| |
|
||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||| ||||| |||||||||| |||||||||| |
|
|
| T |
23029433 |
attaatttgatcgttttcatgtcacccgaaattttcaacgaaatgaatgaacaattcttgagaaaa-caaagtattgaaaagccaaaatcacaaaaacta |
23029335 |
T |
|
| Q |
239 |
acactaaaatcacatgaaatgaatgattacggaacgaaaattactaattcaaaagaaacggttgcataaataaaactaggagatataacattagaattta |
338 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||| || ||||||||||||||||| |
|
|
| T |
23029334 |
accctaaaatcacatgaaatgaatgattacggaacgaaaattactagatcaaaagaaacggttgtataaataaaactactagctataacattagaattta |
23029235 |
T |
|
| Q |
339 |
ccc |
341 |
Q |
| |
|
||| |
|
|
| T |
23029234 |
ccc |
23029232 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 84 - 116
Target Start/End: Complemental strand, 23029467 - 23029435
Alignment:
| Q |
84 |
acaatattaaggtttgcattatagccacaacta |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
23029467 |
acaatattaaggtttgcattatagccacaacta |
23029435 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University