View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1296_low_19 (Length: 374)
Name: NF1296_low_19
Description: NF1296
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1296_low_19 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 262; Significance: 1e-146; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 262; E-Value: 1e-146
Query Start/End: Original strand, 11 - 292
Target Start/End: Complemental strand, 28862414 - 28862133
Alignment:
| Q |
11 |
cagagattcccaagcttcagtaatcattggaactgagttttgcagaagaggatctgacttatcattgggattgtccacctggttagaagaagagttctcc |
110 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28862414 |
cagagattcccaagcttcattaatcattggaactgagttttgcagaagagaatctgccttatcattgggattgtccacctggttagaagaagagttctcc |
28862315 |
T |
 |
| Q |
111 |
tcagttttattcaatgcggaaaagaatgctgcagacagtgttgcacatcgacccaatggtcgatccatatttgcaatttcactagtattgtattgatcaa |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28862314 |
tcagttttattcaatgcggaaaagaatgctgcagacagtgttgcacatcgacccaatggtcgatccatatttgcaatttcactagtattgtattgatcaa |
28862215 |
T |
 |
| Q |
211 |
attctgcaattaagtcagaataatatcaatgagattaaataatcaccatgaatcttaaacctgttcttgtgaaatgctaaat |
292 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||| |
|
|
| T |
28862214 |
attctgcaattaagtcagaataatatcaatgagattaaataatcaacatgaatcttaaacctgttcttgtgaaattctaaat |
28862133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University