View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1296_low_22 (Length: 361)
Name: NF1296_low_22
Description: NF1296
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1296_low_22 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 13 - 258
Target Start/End: Original strand, 21643623 - 21643868
Alignment:
| Q |
13 |
tagggttgaacgctaacatttttcggacatcagacacacatttaatcggatttactgaaaaatcttttgatattgtttgcagctatcagcttcaaaagta |
112 |
Q |
| |
|
|||||||||| ||||| | || ||||||| |||||||| ||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21643623 |
tagggttgaatgctaaaacttgtcggacaccagacacatattcaatcagatttactgaaaaatcttttgatattgtttgcagctatcagcttcaaaagta |
21643722 |
T |
|
| Q |
113 |
tagaaatgcaggttcatttgttctaccagtagatccaaaagacaaagaaacatggggtgatagtgaacacagactagcctacgtatccgaaacaacagta |
212 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21643723 |
tagaaatgcaggctcatttgttctaccagtagatccaaaagacaaagaaacatggggtgatagtgaacacagactagcctacgtatccgaaacaacagta |
21643822 |
T |
|
| Q |
213 |
attttcaaagacatagttcaagtacgcgatgatcaatggtggaaag |
258 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21643823 |
attttcaaagacatagttcaagtacgcgatgatcaatggtggaaag |
21643868 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University