View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1296_low_23 (Length: 351)
Name: NF1296_low_23
Description: NF1296
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1296_low_23 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 153; Significance: 5e-81; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 153; E-Value: 5e-81
Query Start/End: Original strand, 80 - 236
Target Start/End: Complemental strand, 4155989 - 4155833
Alignment:
| Q |
80 |
caccacagactataatggagcttagagcaattgcttgtgtggaggcacagttaggggagcctttgagggaagatggacctattttgggaatcgagtttga |
179 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4155989 |
caccacagactataatggagcttagagcaattgcttgtgtggaggcacagttaggggagcctttgagggaagatggacctattttgggaatcgagtttga |
4155890 |
T |
 |
| Q |
180 |
tccattgccacctgatgcatttggggcacccttaggtatagtcaacgttctttcagc |
236 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
4155889 |
tccattgccacctgatgcatttggggcacccttaggtatagtcaatgttctttcagc |
4155833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 60; Significance: 2e-25; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 93 - 208
Target Start/End: Original strand, 34984263 - 34984378
Alignment:
| Q |
93 |
aatggagcttagagcaattgcttgtgtggaggcacagttaggggagcctttgagggaagatggacctattttgggaatcgagtttgatccattgccacct |
192 |
Q |
| |
|
||||||||||| |||||||||||||||||||| |||||||| || || |||||||| |||| ||| ||| | ||| | |||||||||||||||||||| |
|
|
| T |
34984263 |
aatggagcttaaagcaattgcttgtgtggaggatcagttaggtgaaccattgagggaggatgcacccattataggagttgagtttgatccattgccaccg |
34984362 |
T |
 |
| Q |
193 |
gatgcatttggggcac |
208 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
34984363 |
gatgcatttggggcac |
34984378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University