View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1296_low_31 (Length: 317)
Name: NF1296_low_31
Description: NF1296
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1296_low_31 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 135; Significance: 2e-70; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 99 - 233
Target Start/End: Original strand, 36536455 - 36536589
Alignment:
| Q |
99 |
catccaacactcaacaccttcatattcatcagacaaaatccacaaatctaaccattgttccatacttttactttttaaacaagtaatcaatgaaacagaa |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36536455 |
catccaacactcaacaccttcatattcatcagacaaaatccacaaatctaaccattgttccatacttttactttttaaacaagtaatcaatgaaacagaa |
36536554 |
T |
 |
| Q |
199 |
tccttataaattacaagtttcttataaacttcatc |
233 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
36536555 |
tccttataaattacaagtttcttataaacttcatc |
36536589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University