View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1296_low_33 (Length: 308)
Name: NF1296_low_33
Description: NF1296
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1296_low_33 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 77; Significance: 9e-36; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 77; E-Value: 9e-36
Query Start/End: Original strand, 58 - 134
Target Start/End: Original strand, 29758634 - 29758710
Alignment:
| Q |
58 |
aaaatgagcgagtatacttaatttatatcacccattcagctcctaattcctatcccccaccaccacagccccacata |
134 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29758634 |
aaaatgagcgagtatacttaatttatatcacccattcagctcctaattcctatcccccaccaccacagccccacata |
29758710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University