View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1296_low_36 (Length: 285)
Name: NF1296_low_36
Description: NF1296
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1296_low_36 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 61; Significance: 3e-26; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 1 - 61
Target Start/End: Complemental strand, 3766054 - 3765994
Alignment:
| Q |
1 |
ggtggcatacgggactcatgtaccatcatttgctgattcatggggatgggttatggtatgc |
61 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3766054 |
ggtggcatacgggactcatgtaccatcatttgctgattcatggggatgggttatggtatgc |
3765994 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 186 - 222
Target Start/End: Complemental strand, 41858548 - 41858512
Alignment:
| Q |
186 |
taaaactgaaacactgcaacttaaacaatggggaaag |
222 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||| |
|
|
| T |
41858548 |
taaaactgaaacactgaaacttaaacaatggggaaag |
41858512 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 33; Significance: 0.000000002; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 14 - 58
Target Start/End: Complemental strand, 48388514 - 48388470
Alignment:
| Q |
14 |
actcatgtaccatcatttgctgattcatggggatgggttatggta |
58 |
Q |
| |
|
|||||||||||||| ||||||||| | |||||||||||||||||| |
|
|
| T |
48388514 |
actcatgtaccatcttttgctgatacttggggatgggttatggta |
48388470 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 14 - 58
Target Start/End: Original strand, 9995181 - 9995225
Alignment:
| Q |
14 |
actcatgtaccatcatttgctgattcatggggatgggttatggta |
58 |
Q |
| |
|
|||||||||||||| ||||||||| | |||||||||||| ||||| |
|
|
| T |
9995181 |
actcatgtaccatcttttgctgatacttggggatgggttttggta |
9995225 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 14 - 58
Target Start/End: Complemental strand, 10359365 - 10359321
Alignment:
| Q |
14 |
actcatgtaccatcatttgctgattcatggggatgggttatggta |
58 |
Q |
| |
|
|||||||||||||| ||||||||| | |||||||||||| ||||| |
|
|
| T |
10359365 |
actcatgtaccatcttttgctgatacttggggatgggttttggta |
10359321 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University