View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1296_low_40 (Length: 268)

Name: NF1296_low_40
Description: NF1296
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1296_low_40
NF1296_low_40
[»] chr5 (1 HSPs)
chr5 (47-240)||(3604852-3605046)


Alignment Details
Target: chr5 (Bit Score: 144; Significance: 9e-76; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 144; E-Value: 9e-76
Query Start/End: Original strand, 47 - 240
Target Start/End: Original strand, 3604852 - 3605046
Alignment:
47 ctttttgccctgttctctgtccttgatcaacttccannnnnnnnngt-ggattttctacggtatatatacgatgcaataaaatatgtataatacatagtt 145  Q
    ||||||||||||||||||||| ||||||||||||||          | |||||||||||| |||||||||||||||||||||||||||||||||||||||    
3604852 ctttttgccctgttctctgtctttgatcaacttccattttttttttttggattttctacgctatatatacgatgcaataaaatatgtataatacatagtt 3604951  T
146 acatttggttttttaatttgaaattgcttgcaaaatgtcaaataaaagaatatatttttacacaaatttgaacaaagttttaggtcgtttttcat 240  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||    
3604952 acatttggttttttaatttgaaattgcttgcaaaatgtcaaataaaagaatatatttttacacaaatttgaacaaagttttaggttgtttttcat 3605046  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University