View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1296_low_40 (Length: 268)
Name: NF1296_low_40
Description: NF1296
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1296_low_40 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 144; Significance: 9e-76; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 144; E-Value: 9e-76
Query Start/End: Original strand, 47 - 240
Target Start/End: Original strand, 3604852 - 3605046
Alignment:
| Q |
47 |
ctttttgccctgttctctgtccttgatcaacttccannnnnnnnngt-ggattttctacggtatatatacgatgcaataaaatatgtataatacatagtt |
145 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| | |||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3604852 |
ctttttgccctgttctctgtctttgatcaacttccattttttttttttggattttctacgctatatatacgatgcaataaaatatgtataatacatagtt |
3604951 |
T |
 |
| Q |
146 |
acatttggttttttaatttgaaattgcttgcaaaatgtcaaataaaagaatatatttttacacaaatttgaacaaagttttaggtcgtttttcat |
240 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
3604952 |
acatttggttttttaatttgaaattgcttgcaaaatgtcaaataaaagaatatatttttacacaaatttgaacaaagttttaggttgtttttcat |
3605046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University