View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1296_low_43 (Length: 251)
Name: NF1296_low_43
Description: NF1296
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1296_low_43 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 29 - 251
Target Start/End: Complemental strand, 52372472 - 52372250
Alignment:
| Q |
29 |
aagaataaggactgtgtcacctctttgaagtggaaagaggagttgattggagattatatctacagaggtattgagttgttcataagtgaggtgggtggtg |
128 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52372472 |
aagaataaggactgtgtcacctctttgaagtggaaagaggagttgattggagattatatctacagaggtattgagttgttcataagtgaggtgggtggtg |
52372373 |
T |
 |
| Q |
129 |
gaaattgtgtttaagttgtcttcagcccaaatgaaggctggtttggacttgaaggctggtaacctggcccaaactgggaggtattggtcaaccactggtt |
228 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52372372 |
gaaattgtgtttaagttgtcttcagcccaaatgaaggctggtttggacttgaaggctggtaacctggcccaaactgggaggtattggtcaaccactggtt |
52372273 |
T |
 |
| Q |
229 |
ggtcgggaaaagacgggtcataa |
251 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
52372272 |
ggtcgggaaaagacgggtcataa |
52372250 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University