View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1296_low_44 (Length: 251)
Name: NF1296_low_44
Description: NF1296
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1296_low_44 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 1 - 239
Target Start/End: Complemental strand, 36451818 - 36451580
Alignment:
| Q |
1 |
ccattaggtcccccaccatatttgcgattcttaattggactaagtccaattggcttgcgtccgtctctgtcaccaccatatggataattagtaccataac |
100 |
Q |
| |
|
|||||||| || ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36451818 |
ccattaggaccaccaccatatttgcgattcttaattggactaattccaattggcttgcgtccgtctctgtcaccaccatatggataattagtaccataac |
36451719 |
T |
|
| Q |
101 |
tatcattatggttgttaacggcgctacctccaattggcttacgtccatcagcactaggctgtggtgtatggcgaccgcgatcaacaatgggcccgtacct |
200 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36451718 |
tatcattatggttgttaacggtactacctccaattggcttacgtccatcagcactaggctgtggtgtatggcgaccgcgatcaacaatgggcccgtacct |
36451619 |
T |
|
| Q |
201 |
ttgaggatcacggctaccttcatgattctgctgcacctt |
239 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
36451618 |
ttgaggatcatggctaccttcatgattctgctgcacctt |
36451580 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University