View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1297-Insertion-2 (Length: 266)
Name: NF1297-Insertion-2
Description: NF1297
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1297-Insertion-2 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 137; Significance: 1e-71; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 8 - 195
Target Start/End: Complemental strand, 12245983 - 12245787
Alignment:
| Q |
8 |
gtttgtgatatccatgcctccttttgcaaacaaaaaagatgagatgcttcatattccttcaaatttgatccttgtacaaccaacacaggtaaatatgggt |
107 |
Q |
| |
|
|||||||||||||||||| |||||| ||||||||||||||||| ||||||||| ||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12245983 |
gtttgtgatatccatgccaccttttacaaacaaaaaagatgagttgcttcatactcctttaaatttgatccttgtacaaccaacacaggtaaatatgggt |
12245884 |
T |
|
| Q |
108 |
cctcatc---------ctccaaaatccttcaaagaccagatgtcggtgtcaacattgctgccagtaaaattacatacaaacggatgccactcaatct |
195 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
12245883 |
cctcatcctccttatcctccaaaatccttcaaagaccagatgtcggtgtcaacgttgctgccagtaaaattacatacaaacgaatgccactcaatct |
12245787 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 198 - 266
Target Start/End: Complemental strand, 12245751 - 12245683
Alignment:
| Q |
198 |
ttgccaaaacatagtggaggttcatcgttccaaaagtctaataatttaatttacctccgatccctaaaa |
266 |
Q |
| |
|
||||||||||| || | | ||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
12245751 |
ttgccaaaacacagagaacgttcatcgttccaaaagtcaaataatttaatttacctccgatccctaaaa |
12245683 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University