View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12970_high_13 (Length: 343)
Name: NF12970_high_13
Description: NF12970
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12970_high_13 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 252; Significance: 1e-140; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 252; E-Value: 1e-140
Query Start/End: Original strand, 11 - 321
Target Start/End: Original strand, 43702658 - 43702968
Alignment:
| Q |
11 |
gaagaagggaaaagcaaaggcagaaccaaaggaaacggttccttcggaaaaacctaacaatattccgtcttgtattcgctgcatgcctccttcatccgtc |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43702658 |
gaagaagggaaaagcaaaggcagaaccaaaggaaacggttccttcggaaaaacctaacaatattccgtcttgtattcgctgcatgcctccttcatccgtc |
43702757 |
T |
 |
| Q |
111 |
gctataaccatccacgctaaacccggttcaaagtccgcatccataacaggnnnnnnnnnnnnnnnnngaatgttgcgtttcttcgatattagtttatgaa |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||| |
|
|
| T |
43702758 |
gctataaccatccacgctaaacccggttcaaagtccgcatccataacaggtctctctttctctctctgaatgttgcgtttcttcaatattagtttatgaa |
43702857 |
T |
 |
| Q |
211 |
attgaaatttcggtgtaactgattattggttattgtaataagtagatgtgagcgatgaagctgttggtgttcaaattgatgcaccggcgagggatggcga |
310 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43702858 |
attgaaattacggtgtaactgattattggttattgtaataagtagatgtgagcgatgaagctgttggtgttcaaattgatgcaccggcgagggatggcga |
43702957 |
T |
 |
| Q |
311 |
agcaaatgctg |
321 |
Q |
| |
|
||||||||||| |
|
|
| T |
43702958 |
agcaaatgctg |
43702968 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University