View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12970_high_14 (Length: 335)
Name: NF12970_high_14
Description: NF12970
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12970_high_14 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 203; Significance: 1e-111; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 1 - 227
Target Start/End: Complemental strand, 31643412 - 31643186
Alignment:
| Q |
1 |
tattgacttccattcaccttcatcgcagttggctagtaccgacattggtagtagtatgggcgaacaactcggtccttatgagaaggcgcttcaacaagaa |
100 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
31643412 |
tattgacttccattcaccttcatcacagttggctagtaccgacattggtagtagtatgggcgaacaactcggtcattatgagaaggcgcttcaacaagaa |
31643313 |
T |
|
| Q |
101 |
aattcacatccggttgaaattaaggaagaaccagataataaagaagagaataatgagttcgatttctggatggtacaatcctctgacatgcttaacttat |
200 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||| ||||||||||||||||| |
|
|
| T |
31643312 |
aattcacatctggttgaaattaaggaagaaccagataataaagaagagaataatgagttcgattcccggatggtacaatcctttgacatgcttaacttat |
31643213 |
T |
|
| Q |
201 |
attctaaccgaaccggagggctaacac |
227 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
31643212 |
attctaaccgaaccggagggctaacac |
31643186 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 275 - 323
Target Start/End: Complemental strand, 31643135 - 31643087
Alignment:
| Q |
275 |
catgcctctgtccctcttttagagatggtgaaagcttaccagacatatt |
323 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31643135 |
catgcctctgcccctcttttagagatggtgaaagcttaccagacatatt |
31643087 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University