View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12970_low_11 (Length: 366)
Name: NF12970_low_11
Description: NF12970
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12970_low_11 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 253; Significance: 1e-140; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 253; E-Value: 1e-140
Query Start/End: Original strand, 97 - 353
Target Start/End: Original strand, 37495444 - 37495700
Alignment:
| Q |
97 |
tagtaaattgtgagcgtgtacatgtgaagtgtttagatatgtgtcaatgtgcaaaggaaggaaacagtaagaaggatttgacaaggttaaggtgattagc |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37495444 |
tagtaaattgtgagcgtgtacatgtgaagtgtttagatatgtgtcaatgtgcaaaggaaggaaacagtaagaaggatttgacaaggttaaggtgattagc |
37495543 |
T |
 |
| Q |
197 |
tagctatgtaggccgtactcgtaggtgtcactcacttcttttcaacaagacacgacaattacccacgtcagtatatccaatccaattggtcatacttatc |
296 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37495544 |
tagctatgtaggccgtactcgtaggtgtcactcacttcttttcaacaagacacgacaattacccacgtcagtatatccaatccaattggtcatacttatc |
37495643 |
T |
 |
| Q |
297 |
aagggccccaggtgtaaattcctgcaaattaattacgatttttatacccagaattat |
353 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
37495644 |
aagggccccaggtgtaaattcctgcaaattaattacgatttttatacccaaaattat |
37495700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University