View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12970_low_19 (Length: 235)
Name: NF12970_low_19
Description: NF12970
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12970_low_19 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 189; Significance: 1e-102; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 18 - 222
Target Start/End: Complemental strand, 19199728 - 19199524
Alignment:
| Q |
18 |
ggatgataaacatgtattgcaaatatattgcagtcataaatatcttgcttattgttacaatatttaccatgttaatggtggtaacaagattgaaaaagct |
117 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
19199728 |
ggatggtaaacatgtattgcaaatatattgcagtcatatatatcttgcttattgttacaatatttaccatgtaaatggtggtaacaagattgaaaaagct |
19199629 |
T |
|
| Q |
118 |
agtttttcaacgttattttacaataaattaaatattgaatatgaaaactattgagaacccttgtttgatcagaatctcaccattgaaaatctcatgtttt |
217 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19199628 |
agtttttcaacgttattttgcaataaattaaatattgaatatgaaaactattgagaacccttgtttgatcagaatctcaccattgaaaatctcatgtttt |
19199529 |
T |
|
| Q |
218 |
ctctg |
222 |
Q |
| |
|
||||| |
|
|
| T |
19199528 |
ctctg |
19199524 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 69 - 162
Target Start/End: Complemental strand, 19203361 - 19203268
Alignment:
| Q |
69 |
ttgttacaatatttaccatgttaatggtggtaacaagattgaaaaagctagtttttcaacgttattttacaataaattaaatattgaatatgaa |
162 |
Q |
| |
|
|||||||||||||||||||| ||||||||| |||||||||| ||||||||||||||||| | || ||| |||||| || ||||||||||||||| |
|
|
| T |
19203361 |
ttgttacaatatttaccatgataatggtggcaacaagattggaaaagctagtttttcaaggctagtttgcaataagttgaatattgaatatgaa |
19203268 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 189 - 221
Target Start/End: Complemental strand, 19203244 - 19203212
Alignment:
| Q |
189 |
gaatctcaccattgaaaatctcatgttttctct |
221 |
Q |
| |
|
||||||| ||||||||||||||||||||||||| |
|
|
| T |
19203244 |
gaatctctccattgaaaatctcatgttttctct |
19203212 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University