View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12971_low_8 (Length: 231)
Name: NF12971_low_8
Description: NF12971
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12971_low_8 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 132; Significance: 1e-68; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 53 - 213
Target Start/End: Original strand, 14817519 - 14817681
Alignment:
| Q |
53 |
tgaaaatttatttgtatgtacattttc--tctcacttcatacattatagggtcccccaaatctagcatcccctttataatgttgtctattattggtccag |
150 |
Q |
| |
|
||||||||||||| ||||||||||||| | ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
14817519 |
tgaaaatttatttctatgtacattttccatttcacttcatacattatagggtcccccaaatctagcatccactttataatgttgtctattattggtccag |
14817618 |
T |
 |
| Q |
151 |
cgacctttggggattatttgggtttggttcattggttgtgattttctcctccgctcagttcac |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
14817619 |
cgacctttggggattatttgggtttggttcattggttatcattttctcctccgctcagttcac |
14817681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 13 - 42
Target Start/End: Original strand, 14817476 - 14817505
Alignment:
| Q |
13 |
attatactataactggaaatatattttgtc |
42 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
14817476 |
attatactataactggaaatatattttgtc |
14817505 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University