View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12972_high_4 (Length: 346)
Name: NF12972_high_4
Description: NF12972
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12972_high_4 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 286; Significance: 1e-160; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 286; E-Value: 1e-160
Query Start/End: Original strand, 13 - 346
Target Start/End: Complemental strand, 38482736 - 38482403
Alignment:
| Q |
13 |
cacagagagtaaatacaaacaataggatcatgtttaatgcagtcaaaaattgatacaatcatgtaatcaatgagtttaggccgtcaaatgaagatcacac |
112 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
38482736 |
cacagagagtaaacacaaacaataggatcatgtttgatgcagtcaaaaattgatacaatcatgtaatcaatgagtttaggccgccaaatgaagatcacac |
38482637 |
T |
 |
| Q |
113 |
gatctagattttaatttcagaattttagatctaaactgtctgatcttgattggacggatccgaggtgttaactgcaactaactgcatccaatgccgacta |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
38482636 |
gatctagattttaatttcagaattttagatctaaactgtctgatcttgattggatggatccgaggtgttaactgcaactaactgcatccaatgccgacga |
38482537 |
T |
 |
| Q |
213 |
agcctaatctaattcccaaacaatgatggatggaaccaacacccttgacaatggagctgaaatatcaaaacgagagatagtttcgcttcacattttttga |
312 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||| | ||||||||| |
|
|
| T |
38482536 |
agcctaatctaattcccaaacaatgatagatggaaccaacacccttgacaacggagctgaaatatcagaacgagagatagtttcgcttgatattttttga |
38482437 |
T |
 |
| Q |
313 |
agccccagaaacgaaaatcaaaacaaaaatattt |
346 |
Q |
| |
|
||||||| ||||||||||||||| |||||||||| |
|
|
| T |
38482436 |
agccccaaaaacgaaaatcaaaataaaaatattt |
38482403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University