View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12973_high_19 (Length: 203)
Name: NF12973_high_19
Description: NF12973
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12973_high_19 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 159; Significance: 7e-85; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 159; E-Value: 7e-85
Query Start/End: Original strand, 14 - 184
Target Start/End: Original strand, 37888912 - 37889082
Alignment:
| Q |
14 |
ataatactaagtttgagcaacattaatactaggcagctctttcatgaagatgatgatttattgcttagtagagtcatccatgaaagaagatgttggggat |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37888912 |
ataatactaagtttgagcaacattaatactaggcacctctttcatgaagatgatgatttattgcttagtagagtcatccatgaaagaagatgttggggat |
37889011 |
T |
 |
| Q |
114 |
gatatttggagttgtgatggggactagagctagggttcatatggattcaattttttctttcatcaaatgga |
184 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
37889012 |
gatatttggagttgtgatggggactaaagctagggtttatatggattcaattttttctttcatcaaatgga |
37889082 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University