View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12973_low_10 (Length: 370)
Name: NF12973_low_10
Description: NF12973
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12973_low_10 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 161; Significance: 9e-86; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 161; E-Value: 9e-86
Query Start/End: Original strand, 167 - 355
Target Start/End: Original strand, 518910 - 519098
Alignment:
| Q |
167 |
ttcatgtgctgatcacatttgggcaatgattcacccatgagatgcacttgaactgtcgttggtgaagtccaatacactcaggccccacaaacccttactc |
266 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||| || |||| |
|
|
| T |
518910 |
ttcatgtgctgatcacatttgggcaatgattcacccatgcgatgcacttgaaccgtcgttggtgaagtccaatacactcaggccccacaaacactcactc |
519009 |
T |
|
| Q |
267 |
aaagaaaacagtgaacaagatggaagttgtcaagagatgtttctcgaggcaagatattattcttcagtgatggtggtgacgttattttt |
355 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||| |
|
|
| T |
519010 |
aaagaaaacagtgaacaagatggaagttgtcaagagatgtttctcgaggcaagatattattcttttgtgatggcggtgacgttattttt |
519098 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 1 - 143
Target Start/End: Original strand, 518778 - 518914
Alignment:
| Q |
1 |
gaaggcgatagaatttgtcgtcagaccaaatatcacacaacaaaacagtcataatatatatataaaattttaacagaatttaaatttataattgtttgtt |
100 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
518778 |
gaaggcgatagaatttgtggtcagaccaaatatcacacaacaaaacagtcataatat------aaaattttaacagaatttaaatttataattgtttgtt |
518871 |
T |
|
| Q |
101 |
actcttttgatagcaccgttattacagtctttatatctttcat |
143 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
518872 |
actcttttgatagtaccgttattacagtctttatatctttcat |
518914 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University