View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12973_low_15 (Length: 247)
Name: NF12973_low_15
Description: NF12973
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12973_low_15 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 14 - 228
Target Start/End: Original strand, 46809462 - 46809676
Alignment:
| Q |
14 |
aagaatatttgcaattatgaaaacaagctttggagtattatgaactaacagacaaagaatgaaaaactgagnnnnnnnntaccattcttgatctctttaa |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
46809462 |
aagaatatttgcaattatgaaaacaagctttggagtattatgaactaacagacaaagaatgaaaaactgagaaaaaaaataccattcttgatctctttaa |
46809561 |
T |
 |
| Q |
114 |
gcttccattcgcgagcacttttaatgtctttagctaagccaagaggatttagcagaggacccccagggtacctatttgttgaaacgagattatatacctt |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
46809562 |
gcttccattcgcgagcacttttaatgtctttagctaagccaagaggatttagcagaggacccccagggtacctatttgttgaaacaagattatatacctt |
46809661 |
T |
 |
| Q |
214 |
aactagcttacaatt |
228 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
46809662 |
aactagcttacaatt |
46809676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University