View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12975_low_6 (Length: 216)
Name: NF12975_low_6
Description: NF12975
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12975_low_6 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 107; Significance: 8e-54; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 107; E-Value: 8e-54
Query Start/End: Original strand, 1 - 119
Target Start/End: Complemental strand, 3385057 - 3384939
Alignment:
| Q |
1 |
ctttttggtgtcatccaggtattcttggacttctagagaaattgaagatgcagaaaatgcttccttgctcgtggctgctgatgttatttatagtgatgac |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||| |
|
|
| T |
3385057 |
ctttttggtgtcatccaggtattcttggacttctagagaaattgaagatgcagaaaatgcttcctcgctcctggctgctgatgttatttatagtgatgac |
3384958 |
T |
|
| Q |
101 |
ctgactgatgcattcttca |
119 |
Q |
| |
|
||||| ||||||||||||| |
|
|
| T |
3384957 |
ctgacagatgcattcttca |
3384939 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 107; Significance: 8e-54; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 107; E-Value: 8e-54
Query Start/End: Original strand, 13 - 153
Target Start/End: Original strand, 43912364 - 43912501
Alignment:
| Q |
13 |
atccaggtattcttggacttctagagaaattgaagatgcagaaaatgcttccttgctcgtggctgctgatgttatttatagtgatgacctgactgatgca |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43912364 |
atccaggtattcttggacttctagagaaattgaagatgcagaaaatgcttctttgctcctggctgctgatgttatttatagtgatgacctgactgatgca |
43912463 |
T |
|
| Q |
113 |
ttcttcatcagtaccatagagagattaatgtgaaggagttc |
153 |
Q |
| |
|
|||| |||||||| ||||||||||||||| |||| |||| |
|
|
| T |
43912464 |
ttct---tcagtaccttagagagattaatgtcaaggggttc |
43912501 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 152 - 206
Target Start/End: Complemental strand, 10274274 - 10274220
Alignment:
| Q |
152 |
tcataattgatatgtttaatcttatttgataacacaggctgatttcatgatgatg |
206 |
Q |
| |
|
|||||||||| ||| ||||||||||||||||| |||||||||||||||| |||| |
|
|
| T |
10274274 |
tcataattgacatgcttaatcttatttgataatgcaggctgatttcatgaagatg |
10274220 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University