View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12975_low_7 (Length: 216)

Name: NF12975_low_7
Description: NF12975
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12975_low_7
NF12975_low_7
[»] chr2 (1 HSPs)
chr2 (26-123)||(43912204-43912301)


Alignment Details
Target: chr2 (Bit Score: 90; Significance: 1e-43; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 26 - 123
Target Start/End: Complemental strand, 43912301 - 43912204
Alignment:
26 gttcatccaaggaaattatgaaccgaggggaaaatattgcaaaacatatgacatataccaacattgctgtctcaagttacaaactcaatcccaacccc 123  Q
    |||||||||||||||||||||||||  |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43912301 gttcatccaaggaaattatgaaccggagggaaaatattgcaaaacatatgacatataccaacattgctgtctcaagttacaaactcaatcccaacccc 43912204  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University