View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12976_high_20 (Length: 217)
Name: NF12976_high_20
Description: NF12976
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12976_high_20 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 148; Significance: 3e-78; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 20 - 203
Target Start/End: Complemental strand, 4672678 - 4672496
Alignment:
| Q |
20 |
atagactagtgattcatatatattgttactgatggattctgtggataaattccaatccaaccagttattcacattctcaagattaaagagtaataatgtc |
119 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4672678 |
atagactagtgattcatat----tgttactgatggattctgtggataacttccaatccaaccagttattcacattctcaagattaaagagtaataatgtc |
4672583 |
T |
 |
| Q |
120 |
cgatcaaacccttgtagctatttcacagtctcaag---taatgcatactcgattcaggaaagccattacatcttggtcgtcatatgt |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
4672582 |
cgatcaaacccttgtagctatttcacagtctcaagtaataatgcatactcgattcaggaaagtcattacatcttggtcgtcatatgt |
4672496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University