View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12976_low_14 (Length: 250)
Name: NF12976_low_14
Description: NF12976
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12976_low_14 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 5 - 240
Target Start/End: Original strand, 10055116 - 10055351
Alignment:
| Q |
5 |
tttgtcaattctctatctggttgctctgttataaaaaatctttcagttccaattgcaagaccagaacggtttcatgaaaatctcagagatgaccttagtg |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
10055116 |
tttgtcaattctctatctggttgctctgttataaaaaatctttcagttccaattgcaagaccagaacggtttcaagaaaatctcagagatgaccttagtg |
10055215 |
T |
 |
| Q |
105 |
cagatcttcaattaacatgggataaacctgactgcagttattgtgaatcacatcagctaatgtgtggatttgaaagcattaacagcaatcaagttgtatg |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10055216 |
cagatcttcaattaacatgggataaacctgactgcagttattgtgaatcacatcagctaatgtgtggatttgaaagcattaacagcaatcaagttgtatg |
10055315 |
T |
 |
| Q |
205 |
tttctctgattaccaaccaggtaaacatgtcctatg |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
10055316 |
tttctctgattaccaaccaggtaaacatgtcctatg |
10055351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University