View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12977_high_32 (Length: 322)
Name: NF12977_high_32
Description: NF12977
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12977_high_32 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 18 - 308
Target Start/End: Original strand, 1731829 - 1732119
Alignment:
| Q |
18 |
attatgatttgtgatatagatgttgtttgaggtgtttgatgtagaaaagagtgtaaattgatgaggnnnnnnnnnnnnnnnnnnnnnnngaatgaaagca |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
1731829 |
attatgatttgtgatatagatgttgtttgaggtgtttgatgtagaaaagagtgtaaattgatgaggtttttaattttttgaatttttctgaatgaaagca |
1731928 |
T |
 |
| Q |
118 |
ggaaggtcaatgatgagcatggaggaaggctcaaagaggagacctttctttagctcacctgatgaactgtatgatgaggagtactacgaggagcagtcac |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1731929 |
ggaaggtcaatgatgagcatggaggaaggctcaaagaggagacctttctttagctcacctgatgaactgtatgatgaggagtactacgaggagcagtcac |
1732028 |
T |
 |
| Q |
218 |
cggagaagaagcgccgcctcacttccgagcaggttggttgcttgctttctttgatgaatgaatttggatatgtttttcattatgatgatgt |
308 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
1732029 |
cggagaagaagcgccgcctcacttccgagcaggttggttgcttgctttctttgatgaatgaatttggatatgtttttcactatgatgatgt |
1732119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University