View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12977_high_50 (Length: 207)

Name: NF12977_high_50
Description: NF12977
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12977_high_50
NF12977_high_50
[»] chr1 (2 HSPs)
chr1 (1-70)||(34298222-34298291)
chr1 (93-136)||(34298343-34298386)


Alignment Details
Target: chr1 (Bit Score: 70; Significance: 9e-32; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 70; E-Value: 9e-32
Query Start/End: Original strand, 1 - 70
Target Start/End: Original strand, 34298222 - 34298291
Alignment:
1 tttctgtttgacaagtagttcatgttaacctgttccttttgttttggcggagctaactaccaagttatac 70  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
34298222 tttctgtttgacaagtagttcatgttaacctgttccttttgttttggcggagctaactaccaagttatac 34298291  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 40; E-Value: 0.00000000000007
Query Start/End: Original strand, 93 - 136
Target Start/End: Original strand, 34298343 - 34298386
Alignment:
93 agatattgatccatgaacgtagtttaattgacaagacctatgaa 136  Q
    ||||||||||||||||||||||||||||||||||| ||||||||    
34298343 agatattgatccatgaacgtagtttaattgacaaggcctatgaa 34298386  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University