View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12977_low_16 (Length: 474)
Name: NF12977_low_16
Description: NF12977
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12977_low_16 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 268; Significance: 1e-149; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 268; E-Value: 1e-149
Query Start/End: Original strand, 1 - 327
Target Start/End: Original strand, 16005575 - 16005916
Alignment:
| Q |
1 |
atgtgaatggttacattgattcatatcatgctggtttcgatgctggcctaaatgcagttccatatgagggtgcttatgaaaaaatgcgaggaatgcatga |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
16005575 |
atgtgaatggttacattgattcatatcatgctggtttcgatgctggcctaaatgcagttccatatgagggtgcttatgaaataatgcgaggaatgcatga |
16005674 |
T |
|
| Q |
101 |
tgggttagcagctggtcaacttgctcaagatgaaaatgcacagattgcacatgatgttggggcaaatcaagcacaagaagttgcagaaaatcttgacgca |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||| ||| |
|
|
| T |
16005675 |
tgggttagcagctggtcaacttgctcaagatgaaaatgcacagattgcacatgttgttggggcaaatcaagcacaagaagttgtagaaaatcttgaggca |
16005774 |
T |
|
| Q |
201 |
gaagaaaatgcac---------------aggtagaacaagctgaagaagttgcacagaatctggaggctgaacaagatgaagtttgatttgatatttttt |
285 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16005775 |
gaagaaaatgcacaggttgatgatattgaggtagaacaagctgaagaagttgcacagaatctggaggctgaacaagatgaagtttgatttgatatttttg |
16005874 |
T |
|
| Q |
286 |
ccatgactttactttagtttctttcccgagagatatttgtgc |
327 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
16005875 |
ccatgactttactttagtttctttcccaagagatatttgtgc |
16005916 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University