View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12977_low_24 (Length: 411)
Name: NF12977_low_24
Description: NF12977
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12977_low_24 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 244; Significance: 1e-135; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 147 - 394
Target Start/End: Complemental strand, 15455604 - 15455357
Alignment:
| Q |
147 |
aaactaaaatggaaaaacaaaacaaacaacaatggagacccgaccaagaagcacctcgtgacccaatggaattcttgtcacgttcatggtctgcctctgc |
246 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15455604 |
aaactaaaatggaaaaacaaaacaaacaacaatggagacccgacccagaagcacctcgtgacccaatggaattcttgtcacgttcatggtctgcctctgc |
15455505 |
T |
 |
| Q |
247 |
catggaagtctccaaagctttgtctccagctcaactccctcctctttcaaacaaactcaataatggctcttcaaatgctgctgctatacttgaagatttt |
346 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15455504 |
catggaagtctccaaagctttgtctccagctcaactccctcctctttcaaacaaactcaataatggctcttcaaatgctgctgctatacttgaagatttt |
15455405 |
T |
 |
| Q |
347 |
gctggtgaagttgatgactctattataactgtttctggcaaccctttt |
394 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15455404 |
gctggtgaagttgatgactctattataactgtttctggcaaccctttt |
15455357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 106; E-Value: 6e-53
Query Start/End: Original strand, 10 - 115
Target Start/End: Complemental strand, 15455741 - 15455636
Alignment:
| Q |
10 |
agatgaacccataaaagaaatcaacggtgtgaatcaaacccatctcaattcacccctcactcttccttttcctattaaaaaccacaataaaaccaaacca |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15455741 |
agatgaacccataaaagaaatcaacggtgtgaatcaaacccatctcaattcacccctcactcttccttttcctattaaaaaccacaataaaaccaaacca |
15455642 |
T |
 |
| Q |
110 |
aactac |
115 |
Q |
| |
|
|||||| |
|
|
| T |
15455641 |
aactac |
15455636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University