View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12977_low_30 (Length: 341)
Name: NF12977_low_30
Description: NF12977
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12977_low_30 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 231; Significance: 1e-127; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 90 - 324
Target Start/End: Complemental strand, 47365736 - 47365502
Alignment:
| Q |
90 |
gtattaaatatgtgaaatttgcatataaaattctagtatctgttcctaagttcaccttcagtttgtctgtccttaattgtactatgtttgtcacaaaaat |
189 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47365736 |
gtattaaatatgtgaaatttgcatataaaattctagtatctgttcctaagttcaccttcagtttgtctgtccttaattgtactatgtttgtcacaaaaat |
47365637 |
T |
 |
| Q |
190 |
aattgagcatttagcagaaggggaaaactatgaaaaaagggtttaagttgatacaaatgaaaggtgaaagtgaatacaaaactcactatgtagcctctaa |
289 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
47365636 |
aattgagcatttagcagaaggggaaaactatgaaaaaagggtttaagttgatacaaatgaaaggtaaaagtgaatacaaaactcactatgtagcctctaa |
47365537 |
T |
 |
| Q |
290 |
atgttgtttgaattttgatagctgaagattcttca |
324 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
47365536 |
atgttgtttgaattttgatagctgaagattcttca |
47365502 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 1 - 33
Target Start/End: Complemental strand, 47365825 - 47365793
Alignment:
| Q |
1 |
gtgacttcagtttgtcaatctaatccactaaag |
33 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
47365825 |
gtgacttcagtttgtcaatctaatccactaaag |
47365793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University