View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12977_low_41 (Length: 250)
Name: NF12977_low_41
Description: NF12977
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12977_low_41 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 104; Significance: 6e-52; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 104; E-Value: 6e-52
Query Start/End: Original strand, 126 - 241
Target Start/End: Original strand, 15455839 - 15455954
Alignment:
| Q |
126 |
acaattttgtgtcttcaaaattacggtagtattgacaatgaagtaattaatggatgagtggatggatggtttggttatgtggtgataaaaattgaatttg |
225 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
15455839 |
acaattttgtgtcttcaaaattacggtagtattgacaatgaagtaattaatggatgagtggatggatggtttggttatgtggtgataaaaattaaatttg |
15455938 |
T |
 |
| Q |
226 |
aataggctgatgatgt |
241 |
Q |
| |
|
|||||| |||| |||| |
|
|
| T |
15455939 |
aataggttgattatgt |
15455954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 101; E-Value: 4e-50
Query Start/End: Original strand, 1 - 101
Target Start/End: Original strand, 15455718 - 15455818
Alignment:
| Q |
1 |
ttgatttcttttatgggttcatctacggccagtgtttgttacttgcaaacaacctttgtaaagtttgtactactaacaagaataatatcttaaaagttgg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15455718 |
ttgatttcttttatgggttcatctacggccagtgtttgttacttgcaaacaacctttgtaaagtttgtactactaacaagaataatatcttaaaagttgg |
15455817 |
T |
 |
| Q |
101 |
a |
101 |
Q |
| |
|
| |
|
|
| T |
15455818 |
a |
15455818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 195 - 228
Target Start/End: Original strand, 9449138 - 9449171
Alignment:
| Q |
195 |
tttggttatgtggtgataaaaattgaatttgaat |
228 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||| |
|
|
| T |
9449138 |
tttggttatgtggtgataaaaattgattttgaat |
9449171 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University