View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12977_low_43 (Length: 244)
Name: NF12977_low_43
Description: NF12977
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12977_low_43 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 109; Significance: 6e-55; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 109; E-Value: 6e-55
Query Start/End: Original strand, 85 - 201
Target Start/End: Original strand, 5441957 - 5442072
Alignment:
| Q |
85 |
tgatcgtatatccccacagtaaatgatgagttatcactatataatgcctaaaagtgagaatttcatttgtaaaacaattactatgaaatgagtaattttt |
184 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5441957 |
tgatcgtatatccc-acagtaaatgatgagttatcactatataatgcctaaaagtgagaatttcatttgtaaaacaattactatgaaatgagtaattttt |
5442055 |
T |
 |
| Q |
185 |
gcagcaaaacaatgtaa |
201 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
5442056 |
gcagcaaaacaatgtaa |
5442072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 5441881 - 5441928
Alignment:
| Q |
1 |
ggatcaatgttcttcacataggaaaagtgacgagctggtaagcctaat |
48 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
5441881 |
ggatcaatgttcttcacataggaaaagtgtcgagctggtaagcctaat |
5441928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University