View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12977_low_49 (Length: 231)
Name: NF12977_low_49
Description: NF12977
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12977_low_49 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 126; Significance: 4e-65; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 2 - 127
Target Start/End: Original strand, 35163629 - 35163754
Alignment:
| Q |
2 |
cagaccaaaaatccaacatagcaaaccttaaactctctgtttcagacctacctatgttgtcttgtcactacatccaaaaaggttgtctcttcacaaaacc |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35163629 |
cagaccaaaaatccaacatagcaaaccttaaactctctgtttcagacctacctatgttgtcttgtcactacatccaaaaaggttgtctcttcacaaaacc |
35163728 |
T |
 |
| Q |
102 |
ttcaaacattcctttccatattttaa |
127 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
35163729 |
ttcaaacattcctttccatattttaa |
35163754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 181 - 217
Target Start/End: Original strand, 35163808 - 35163844
Alignment:
| Q |
181 |
gccggtcgtttaaccaccgactctgagggctatgttt |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35163808 |
gccggtcgtttaaccaccgactctgagggctatgttt |
35163844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University