View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12977_low_52 (Length: 213)
Name: NF12977_low_52
Description: NF12977
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12977_low_52 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 40; Significance: 0.00000000000008; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 1 - 40
Target Start/End: Original strand, 48570397 - 48570436
Alignment:
| Q |
1 |
aatctaacttaatgatatcgatttattccaacaaagtagc |
40 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48570397 |
aatctaacttaatgatatcgatttattccaacaaagtagc |
48570436 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University