View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12978_high_13 (Length: 379)
Name: NF12978_high_13
Description: NF12978
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12978_high_13 |
 |  |
|
| [»] chr8 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 302; Significance: 1e-170; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 302; E-Value: 1e-170
Query Start/End: Original strand, 62 - 379
Target Start/End: Original strand, 43540008 - 43540325
Alignment:
| Q |
62 |
tacaaacaaaggtgcccatgaatacgtcattatatcaaatggatgttgaccgacaaatatgcattgtatcaaataccagaacttacctcctctactccat |
161 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
43540008 |
tacaaacaaaggtgcccatgaatatgtcattatatcaaatggatgttgactgacaaatatgcatactatcaaataccagaacttacctcctctactccat |
43540107 |
T |
 |
| Q |
162 |
ctgtgtctgtaatgtctaaatatcctttgataagggagttgaaaactacaggatttggatgcactccaagctccttcattttgtatagaaatctcaaggc |
261 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43540108 |
ctgtgtctgtaatgtctaaatatcctttgataagggagttgaaaactacaggatttggatgcactccaagctccttcattttgtatagaaatctcaaggc |
43540207 |
T |
 |
| Q |
262 |
ttctgtcatgttaccttccttacaataaccgcgtattatgataccgcaggttcgttcattaggcttcactttgttattatactgctgcattttcaatatc |
361 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43540208 |
ttctgtcatgttaccttccttacaataaccgcgtattatgataccgcaggttcgttcattaggcttcactttgttattatactgctgcattttcaatatc |
43540307 |
T |
 |
| Q |
362 |
aacctttccgcattatct |
379 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
43540308 |
aacctttccgcattatct |
43540325 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 6 - 51
Target Start/End: Original strand, 43539943 - 43539988
Alignment:
| Q |
6 |
agcagcacagatttaggtagggacacttcaaacacataataccttc |
51 |
Q |
| |
|
|||| |||| |||||||||||||||| ||||||||||||||||||| |
|
|
| T |
43539943 |
agcaacacaaatttaggtagggacacatcaaacacataataccttc |
43539988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University