View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12978_high_27 (Length: 235)
Name: NF12978_high_27
Description: NF12978
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12978_high_27 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 1 - 220
Target Start/End: Original strand, 43540307 - 43540526
Alignment:
| Q |
1 |
caacctttccgcattatctgtctcaccattctgagcaaacgccctcgccagtgtgttgtatgtgacaatgtccggctgcatgccagagttcaccatttta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43540307 |
caacctttccgcattatctgtctcaccattctgagcaaacgccctcgccagtgtgttgtatgtgacaatgtccggctgcatgccagagttcaccatttta |
43540406 |
T |
 |
| Q |
101 |
tgcataacattccatgcctcttccaattcattcttggtacaccatgcttggatgagaatattatatgttctctcgttcggtttcacatttccatcctgaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
43540407 |
tgcataacattccatgcctcttccaattcattcttggtacaccatgcttggatgagaatattatatgttctctcattcggtttcacatttccatcctgaa |
43540506 |
T |
 |
| Q |
201 |
tcatcatctctagcaatttc |
220 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
43540507 |
tcatcatctctagcaatttc |
43540526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University