View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12978_high_28 (Length: 211)
Name: NF12978_high_28
Description: NF12978
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12978_high_28 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 12 - 199
Target Start/End: Complemental strand, 2381864 - 2381677
Alignment:
| Q |
12 |
gaatttgatgatgactatgcattgacaatcttccaatgaaaattcattaccatgtcgtagacnnnnnnngtaacgtctttaaatttgtttttatcggttt |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||| |||| |
|
|
| T |
2381864 |
gaatttgatgatgactatgcattgacaatcttccaatgaaaattcattaccatgtcgtagactttttttgtaacgtctttaaatttatttttatcagttt |
2381765 |
T |
|
| Q |
112 |
atgaagtgataaacatcatccgaaacttacacacaaagctgtaagatcacggtttaaaatcagatgaatatgtctaaccttgtaatat |
199 |
Q |
| |
|
||||||||| |||||||||| ||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2381764 |
atgaagtgaaaaacatcatctgaaacttacacacaaagttgtaaaatcacggtttaaaatcagatgaatatgtctaaccttgtaatat |
2381677 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University