View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12978_low_18 (Length: 314)
Name: NF12978_low_18
Description: NF12978
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12978_low_18 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 269; Significance: 1e-150; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 269; E-Value: 1e-150
Query Start/End: Original strand, 17 - 297
Target Start/End: Complemental strand, 33440765 - 33440485
Alignment:
| Q |
17 |
acctttgaccctttagtttctctggactatacaatgctggtgtgaggtttggagtatcagcatcccaccatccagctgttcccctttgtgcaccattgat |
116 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33440765 |
acctttgaccctttagtttctctggattatacaatgctggtgtgaggtttggagtatcagcatcccaccatccagctgttcccctttgtgcaccattgat |
33440666 |
T |
|
| Q |
117 |
gaacaaaagttgtccatttgggaggattatacaatctcccattattctccttgatggcatgtcttcagtttcccatctcgcgatttgatccgtgagtacc |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||| |
|
|
| T |
33440665 |
gaacaaaagttgtccatttgggaggattatacaatctcccattattctccttgatggcatgtcttcagtttcccatctcgcgatttgatctgtgattacc |
33440566 |
T |
|
| Q |
217 |
atcctgatttataaaaacaaaatgttagaatctaagaaacactggacacgacactgatatcaataaatttaagtaatcaca |
297 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33440565 |
atcctgatttataaaaacaaaatgttagaatctaagaaacactggacacgacactgatatcaataaatttaagtaatcaca |
33440485 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 48; Significance: 2e-18; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 73 - 176
Target Start/End: Complemental strand, 43343880 - 43343777
Alignment:
| Q |
73 |
tcagcatcccaccatccagctgttcccctttgtgcaccattgatgaacaaaagttgtccatttgggaggattatacaatctcccattattctccttgatg |
172 |
Q |
| |
|
||||||||||||||| ||| ||| || ||||||||||||||||||||| |||| ||||||||||||||| | | ||||||||| |||||||||||| |
|
|
| T |
43343880 |
tcagcatcccaccatgcagatgtaccgtattgtgcaccattgatgaacaatagttctccatttgggaggataagagcatctcccatggttctccttgatg |
43343781 |
T |
|
| Q |
173 |
gcat |
176 |
Q |
| |
|
|||| |
|
|
| T |
43343780 |
gcat |
43343777 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University