View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12978_low_19 (Length: 271)
Name: NF12978_low_19
Description: NF12978
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12978_low_19 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 13 - 253
Target Start/End: Complemental strand, 41620488 - 41620248
Alignment:
| Q |
13 |
attcttactagcttcttattgcaactagagagaaactgataatctcattgattgattcaacttcatgcttcttagaacttttgaattctaatacaaagta |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41620488 |
attcttactagcttcttattgcaactagagagaaactgataatctcattgattgattcaacttcatgcttcttagaacttttgaattctaatacaaagta |
41620389 |
T |
|
| Q |
113 |
tgtaactatgtatgacaatggtgaagtagtaaagaaattagcctaaagagaatcaaaatgataagtagaaaatgatgtgaaagatgtactgtttcaatga |
212 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||| |
|
|
| T |
41620388 |
tgtaactatgtatgacaatggttaagtagtaaaaaaattagcctaaagagaatcaaaatgataagtagaaaatgatgtgaaagaggtactgtttcattga |
41620289 |
T |
|
| Q |
213 |
gaatctaaaacaacttttccaactttcaagagaagacaaag |
253 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41620288 |
gaatctaaaacaacttttccaactttcaagagaagacaaag |
41620248 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University