View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12978_low_23 (Length: 264)
Name: NF12978_low_23
Description: NF12978
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12978_low_23 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 11 - 248
Target Start/End: Original strand, 34187190 - 34187427
Alignment:
| Q |
11 |
atatgacaggtagaaaggactggttttcttcacttgatgcttctttttgtgatgaggtaaaattaggaaataattatgctcttaaggtcaatgggaaggg |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34187190 |
atatgacaggtagaaaggactggttttcttcacttgatgcttctttttgtgatgaggtaaaattaggaaataattatgctcttaaggtcaatgggaaggg |
34187289 |
T |
 |
| Q |
111 |
tgttgtcaaacttttgattaatggagttatgcatttggtgaatgatgtattttatgtgcctgagttaaaaaataatttatttagtgtggggcaatttttg |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34187290 |
tgttgtcaaacttttgattaatggagttatgcattttgtgaatgatgtattttatgtgcctgagttaaaaaataatttatttagtgtggggcaatttttg |
34187389 |
T |
 |
| Q |
211 |
gaaagaggattgaatgttgaaatgaagcaaaacaagtg |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34187390 |
gaaagaggattgaatgttgaaatgaagcaaaacaagtg |
34187427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University