View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12978_low_24 (Length: 254)
Name: NF12978_low_24
Description: NF12978
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12978_low_24 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 19 - 243
Target Start/End: Original strand, 42070636 - 42070860
Alignment:
| Q |
19 |
aattttatatacgatacaccttttgtgtgtatgataatttttcaattgttttctatatagtttaagaatttaattttagaaaaaccctattcaaacattt |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42070636 |
aattttatatacgatacaccttttgtgtgtatgataatttttcaattgttttccatatagtttaagaatttaattttagaaaaaccctattcaaacattt |
42070735 |
T |
 |
| Q |
119 |
gatgatatataggtgcaccaccactaccaaggccataaaaccacgacaagtctcatttagtggagtttatgatgacatcaatcccaccatgtcatgacgt |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42070736 |
gatgatatataggtgcaccaccactaccaaggccataaaaccacgacaagtctcatttagtggagtttatgatgacatcaatcccaccatgtcatgacgt |
42070835 |
T |
 |
| Q |
219 |
cttttctttcaatcttagtgcctat |
243 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
42070836 |
cttttctttcaatcttagtgcctat |
42070860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University