View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12978_low_28 (Length: 235)
Name: NF12978_low_28
Description: NF12978
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12978_low_28 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 20 - 199
Target Start/End: Original strand, 6650704 - 6650883
Alignment:
| Q |
20 |
tagtggtgggtttgatgtggattcagtttctaattcttctgctggtggtgggttcaaccaagtgtccccagtttctgctgttggtgttgctgctgatcaa |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6650704 |
tagtggtgggtttgatgtggattcagtttctaattcttctgctggtggtgggttcaaccaagtgtccccagtttctgctgttggtgttgctgctgatcaa |
6650803 |
T |
|
| Q |
120 |
ttgtctccttctttggctttgggatcttttgataatacttatcatcacatgcaacaagcacaacaaggacaaggaggaga |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6650804 |
ttgtctccttctttggctttgggatcttttgataatacttatcatcacatgcaacaagcacaacaaggacaaggaggaga |
6650883 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University