View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12979_high_23 (Length: 224)
Name: NF12979_high_23
Description: NF12979
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12979_high_23 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 28 - 207
Target Start/End: Complemental strand, 40863312 - 40863130
Alignment:
| Q |
28 |
agtatcactaaaataaacaccattgttgcgaacataattaagcctaaaaagtagagacacgggtaagtgttgaatatattatccccgaaactgaaaactt |
127 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40863312 |
agtaccactaaaataaacaccattgttgcgaacataattaagcctaaaaagtagagacacgagtaagtgttgaatatattatccccgaaactgaaaactt |
40863213 |
T |
 |
| Q |
128 |
acaccacacttgcttgttgc---atttttcctaccgtccaactccacaccgaatgctaccagcttacaagtttcagtggaaag |
207 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40863212 |
tcaccacacttgcttgttgcattatttttcctaccgtccaactccacaccgaatgctaccagcttacaagtttcagtggaaag |
40863130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University