View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12979_low_22 (Length: 236)
Name: NF12979_low_22
Description: NF12979
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12979_low_22 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 116; Significance: 4e-59; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 116; E-Value: 4e-59
Query Start/End: Original strand, 1 - 116
Target Start/End: Original strand, 34875162 - 34875277
Alignment:
| Q |
1 |
atattcatttaagtgctcatcgtagattgaataataagatagcaactaaataattaaaatcaataacctcaatagttatgacaattcttatgcaaagctt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34875162 |
atattcatttaagtgctcatcgtagattgaataataagatagcaactaaataattaaaatcaataacctcaatagttatgacaattcttatgcaaagctt |
34875261 |
T |
 |
| Q |
101 |
ttttcattaaagttta |
116 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
34875262 |
ttttcattaaagttta |
34875277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 1 - 116
Target Start/End: Original strand, 34867220 - 34867335
Alignment:
| Q |
1 |
atattcatttaagtgctcatcgtagattgaataataagatagcaactaaataattaaaatcaataacctcaatagttatgacaattcttatgcaaagctt |
100 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||| ||||||||||| ||||||| ||||| || |
|
|
| T |
34867220 |
atattcatttaagtgctcatcggagattgaataataagatagcaagtaaataattaaaatcaataactacaatagttatgcgaattcttgtgcaagcttt |
34867319 |
T |
 |
| Q |
101 |
ttttcattaaagttta |
116 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
34867320 |
ttttcattaaagttta |
34867335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University