View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12979_low_23 (Length: 236)
Name: NF12979_low_23
Description: NF12979
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12979_low_23 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 110; Significance: 1e-55; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 110; E-Value: 1e-55
Query Start/End: Original strand, 68 - 222
Target Start/End: Original strand, 54717542 - 54717694
Alignment:
| Q |
68 |
gagaaactagttctccactcataatattagaggggttagttgtaccgaaaaaatagtagaggggttagttggtctccaaattgaaaatattggagctaat |
167 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54717542 |
gagaaactagttctccactcataatattagaggggttagatgtaccgaaaaaatagtagaggggttagttggtctccaaattgaaaatattggagctaat |
54717641 |
T |
|
| Q |
168 |
ttggtannnnnnnngtcagaagaaaaataaaatgtcaggaactaaattaattatt |
222 |
Q |
| |
|
|| ||| ||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
54717642 |
ttagta-tttttttgtcagaa-aaaaataaaatgtcaggaactaaattaattatt |
54717694 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 1 - 51
Target Start/End: Original strand, 54717462 - 54717512
Alignment:
| Q |
1 |
ttaattgacttcctagctagcacaaaatagcatccacaatttagtctataa |
51 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
54717462 |
ttaattgacttcctagctagcaaaaaatagcatccacaatttagtctataa |
54717512 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University