View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1297_high_103 (Length: 250)
Name: NF1297_high_103
Description: NF1297
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1297_high_103 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 154; Significance: 9e-82; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 154; E-Value: 9e-82
Query Start/End: Original strand, 30 - 219
Target Start/End: Original strand, 44767048 - 44767237
Alignment:
| Q |
30 |
gttctcaaaactattgattttgggctgtctgttttttataagccaggtttggaattctttttcctttctatttctattttgatcaatatgtgaagtgatg |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44767048 |
gttctcaaaactattgattttgggctgtctgttttttataagccaggtttagttttctttttcctttctatttctattttgatcaatatgtgaagtgatg |
44767147 |
T |
 |
| Q |
130 |
aatgattttataatgttttcacatctggggcaatgttcagatgcgacggtttttatcatgatggaattctttttgttcaaattaattgat |
219 |
Q |
| |
|
|||||| ||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
44767148 |
aatgatcttataatgttttcacatctagggcaatgttcagatgcggtcgtttttatcatgatggaattttttttgttcaaattaattgat |
44767237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 31 - 80
Target Start/End: Original strand, 44756956 - 44757005
Alignment:
| Q |
31 |
ttctcaaaactattgattttgggctgtctgttttttataagccaggtttg |
80 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||| |||||||||||| |
|
|
| T |
44756956 |
ttctcaaaactattgattttggtttgtctgttttttacaagccaggtttg |
44757005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 30 - 72
Target Start/End: Complemental strand, 23256300 - 23256258
Alignment:
| Q |
30 |
gttctcaaaactattgattttgggctgtctgttttttataagc |
72 |
Q |
| |
|
||||||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
23256300 |
gttctcaaaactattgattttggaatgtttgttttttataagc |
23256258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University