View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1297_high_15 (Length: 519)
Name: NF1297_high_15
Description: NF1297
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1297_high_15 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 119; Significance: 1e-60; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 119; E-Value: 1e-60
Query Start/End: Original strand, 176 - 306
Target Start/End: Original strand, 42087496 - 42087626
Alignment:
| Q |
176 |
cttgacagaattaggaaaggaagtttctagtcacaaacatgaacaagtgctttttgccagcaaatctattagatagacaatttggtcgatgacagtttta |
275 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
42087496 |
cttgacagaattaggaaaggaagtttctactcacaaacatgaacaagtgctttttgctagcaaatctattagatagacaatttggtcgatgacagttgta |
42087595 |
T |
 |
| Q |
276 |
gagcaaaatttggtttatagttagaaaatgc |
306 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
42087596 |
gagcaaaatttggtttatagttagaaaatgc |
42087626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 105; E-Value: 3e-52
Query Start/End: Original strand, 361 - 508
Target Start/End: Original strand, 42087673 - 42087823
Alignment:
| Q |
361 |
tgctagacgtcactcttcctagcatatccagcnnnnnnntaaactcttctgcttctagcatgtatggagtagt----taatcttgtagctgtgtggactg |
456 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||| |||||||||||| |
|
|
| T |
42087673 |
tgctagacgtcactcttcctagcatatccagcaaaaaa-taaactcttctgcttctagcatgtatggagtagttagttaatcttgtatctgtgtggactg |
42087771 |
T |
 |
| Q |
457 |
tcggtgccacattcactcgttgttctgactttttcttctttgggttattcat |
508 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42087772 |
tcggtgccacattcactcgttgttctgactttttcttctttgggttattcat |
42087823 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 91; E-Value: 7e-44
Query Start/End: Original strand, 29 - 119
Target Start/End: Original strand, 42087349 - 42087439
Alignment:
| Q |
29 |
agaataaccggcgaaactagttgtgtatgatcagttgaatctattttcaccaaatttgtgatatgattgcagtggaataatggcaggattg |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42087349 |
agaataaccggcgaaactagttgtgtatgatcagttgaatctattttcaccaaatttgtgatatgattgcagtggaataatggcaggattg |
42087439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University