View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1297_high_36 (Length: 378)
Name: NF1297_high_36
Description: NF1297
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1297_high_36 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 254; Significance: 1e-141; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 254; E-Value: 1e-141
Query Start/End: Original strand, 10 - 275
Target Start/End: Complemental strand, 51377027 - 51376763
Alignment:
| Q |
10 |
aagaatatacaacttccaagttctttttacctatttgctcaatggaaaaacggtgtgcacttgctcatttacgtattcatagttttattgaatcacaggc |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51377027 |
aagaatatacaacttccaagttctttttacctatttgctcaatggaaaaacg-tgtgcacttgctcatttacgtattcatagttttattgaatcacaggc |
51376929 |
T |
 |
| Q |
110 |
aagtggaacaaggataatagaaaagggaaaagaaaatgagtgggtacgaaggagaaagaattttggtgtaaaaccctaaaaatagatatgggcaaagcat |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51376928 |
aagtggaacaaggataatagaaaagggaaaagaaaatgagtgggtacgaaggagaaagaattttggtgtaaaaccctaaaaatagatatgggcaaagcat |
51376829 |
T |
 |
| Q |
210 |
gagcatgctgggagtgacaaagaccactcactgtatattccttcgagaaaaacatagtgtagtgtg |
275 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51376828 |
gagcatgctggaagtgacaaagaccactcactgtatattccttcgagaaaaacatagtgtagtgtg |
51376763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University