View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1297_high_39 (Length: 370)
Name: NF1297_high_39
Description: NF1297
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1297_high_39 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 206; Significance: 1e-112; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 206; E-Value: 1e-112
Query Start/End: Original strand, 1 - 250
Target Start/End: Original strand, 47654036 - 47654285
Alignment:
| Q |
1 |
tgtcggatatatacaagagaagacccatatacccaatgcattgagattttatatggagatgtgatttttgatctcgtaatcctagatcattggtttgttg |
100 |
Q |
| |
|
|||| ||||||| ||||||||||| ||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
47654036 |
tgtcagatatatgcaagagaagactcatatactcaatgcattgagattttatatggagacatgatttttgatctcgtaatcctagatcgttggtttgttg |
47654135 |
T |
 |
| Q |
101 |
ttattttcggcgctcttcataaatctccaacataattaaactgttagaacaacaaccaattatgaaaggaaaattaaacggcaaccgtaaacaatagata |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
47654136 |
ttattttcggcgctcttcataaatctccaacataaataaactgttagaacaacaaccaattatgaaagggaaattaaacggcaaccgtaaacaatagata |
47654235 |
T |
 |
| Q |
201 |
aacgaagtttggtaataaaattcggtcaattgtgcccgtataattgtgta |
250 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
47654236 |
aacaaagtttggtaataaaattcggtcaattgtgcccgtataatcgtgta |
47654285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University