View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1297_high_50 (Length: 316)
Name: NF1297_high_50
Description: NF1297
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1297_high_50 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 82; Significance: 1e-38; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 84 - 226
Target Start/End: Complemental strand, 32572364 - 32572222
Alignment:
| Q |
84 |
gtttaaggggttcaaattttttaccatcggaacaaatctattgttggttgnnnnnnnggaaggnnnnnnnngttgtcgatgatgagttttgtttttggta |
183 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| |||||||||||| | |||| ||||| ||||||||||||||||||||||| |
|
|
| T |
32572364 |
gtttaaggggttcaaattttttaccaccggaacaaatatattgttggttgtttttttgaaaggaaaaaaaagttgttgatgatgagttttgtttttggta |
32572265 |
T |
|
| Q |
184 |
taatgaacatgagtttattgtagttacacgtatatcacaaatg |
226 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32572264 |
taatgaacatgagtttattgtagttacacgtatatcacaaatg |
32572222 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 226 - 311
Target Start/End: Complemental strand, 32572184 - 32572099
Alignment:
| Q |
226 |
gcaatacattacccaaataaagggtggtctaaatttactcaccatgcaatttaattttgtctctatactttcgttcctttgcttct |
311 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||| |
|
|
| T |
32572184 |
gcaatacattacccaaataaagggtggtctaaatttactcaccatgcattttaattttgtctctatactttcgttcctttgtttct |
32572099 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University